Mature sequence mja-miR-6489-5p

Accession numberMIMAT0025296
IDmja-miR-6489-5p
Stem-Loop mja-mir-6489
Sequence
ggcaccggacuggcgcccuu
Get sequence
Deep sequencing reads, experiments

References

1