Mature sequence mja-miR-6489-3p

Accession numberMIMAT0025297
IDmja-miR-6489-3p
Stem-Loop mja-mir-6489
Sequence
cgacggaaagguguccaagcugg
Get sequence
Deep sequencing reads, experiments

References

1