Mature sequence ssc-miR-9

Accession numberMIMAT0025358
IDssc-miR-9
Stem-Loop ssc-mir-9-3
Sequence
ucuuugguuaucuagcuguaug
Get sequence
Deep sequencing791 reads, 11 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).