Mature sequence bta-miR-376e

Accession numberMIMAT0025543
IDbta-miR-376e
Stem-Loop bta-mir-376e
Sequence
aacauagaggaaaauccacauu
Get sequence
Deep sequencing1356 reads, 64 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).