Mature sequence gga-miR-107-5p

• Accession number: MIMAT0026520
• ID: gga-miR-107-5p
• Stem-Loop: gga-mir-107
• Sequence: agcuucuuuacaguguugccuug
• Deep sequencing: 18 reads, 5 experiments
• Predicted targets:
  • TargetScanVert:gga-miR-107-5p
  • miRDB:gga-miR-107-5p

References

1. " McBride D, Carre W, Law A, Clinton M Unpublished.
2. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).