Mature sequence hsa-miR-1910-3p

Accession numberMIMAT0026917
IDhsa-miR-1910-3p
Stem-Loop hsa-mir-1910
Sequence
gaggcagaagcaggaugaca
Get sequence
Deep sequencing156 reads, 42 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).