Mature sequence ppe-miR171f

Accession numberMIMAT0027274
IDppe-miR171f
Stem-Loop ppe-MIR171f
Sequence
ugauugagccgugccaauauc
Get sequence
Deep sequencing reads, experiments

References

1