Mature sequence ppe-miR828-3p

Accession numberMIMAT0027282
IDppe-miR828-3p
Stem-Loop ppe-MIR828
Sequence
ucauuucagcaagcagcguua
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).