Mature sequence ppe-miR171h

Accession numberMIMAT0027285
IDppe-miR171h
Stem-Loop ppe-MIR171h
Sequence
uugagccgcgucaauaucucc
Get sequence
Deep sequencing reads, experiments

References

1