Mature sequence ssc-miR-7136-5p

Accession numberMIMAT0028147
IDssc-miR-7136-5p
Stem-Loop ssc-mir-7136
Sequence
ucugguccagacacuguggagc
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).