Mature sequence mes-miR169k

Accession numberMIMAT0029219
IDmes-miR169k
Stem-Loop mes-MIR169k
Sequence
gagccaagaaugacuugccgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).