Mature sequence mes-miR169ac

Accession numberMIMAT0029237
IDmes-miR169ac
Stem-Loop mes-MIR169ac
Sequence
uagccaaggaugacuugccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).