Mature sequence mes-miR395c

Accession numberMIMAT0029270
IDmes-miR395c
Stem-Loop mes-MIR395c
Sequence
cugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).