Mature sequence ipu-let-7b

Accession numberMIMAT0029375
IDipu-let-7b
Stem-Loop ipu-let-7b-2 ipu-let-7b-1
Sequence
ugagguaguagguuguguggu
Get sequence
Deep sequencing reads, experiments

References

1