Mature sequence ipu-miR-107a

Accession numberMIMAT0029389
IDipu-miR-107a
Stem-Loop ipu-mir-107a
Sequence
agcagcauuguacagggcuauc
Get sequence
Deep sequencing reads, experiments

References

1