Mature sequence ipu-miR-126b

Accession numberMIMAT0029401
IDipu-miR-126b
Stem-Loop ipu-mir-126b
Sequence
cauuauuacuuuugguacgcg
Get sequence
Deep sequencing reads, experiments

References

1