Mature sequence ipu-miR-132a

Accession numberMIMAT0029405
IDipu-miR-132a
Stem-Loop ipu-mir-132a
Sequence
accguggcuuuagauuguuacu
Get sequence
Deep sequencing reads, experiments

References

1