Mature sequence ipu-miR-15a

Accession numberMIMAT0029430
IDipu-miR-15a
Stem-Loop ipu-mir-15a-1 ipu-mir-15a-2
Sequence
uagcagcacagaaugguuugu
Get sequence
Deep sequencing reads, experiments

References

1