Mature sequence ipu-miR-30b

Accession numberMIMAT0029497
IDipu-miR-30b
Stem-Loop ipu-mir-30b
Sequence
uguaaacauccuacacucagcu
Get sequence
Deep sequencing reads, experiments

References

1