Mature sequence ipu-miR-457a

Accession numberMIMAT0029515
IDipu-miR-457a
Stem-Loop ipu-mir-457a
Sequence
aagcagcacaucaauauuggca
Get sequence
Deep sequencing reads, experiments

References

1