Mature sequence ipu-miR-7553

Accession numberMIMAT0029549
IDipu-miR-7553
Stem-Loop ipu-mir-7553
Sequence
ugacgucauuagcgacccgacc
Get sequence
Deep sequencing reads, experiments

References

1