Mature sequence ipu-miR-7573

Accession numberMIMAT0029572
IDipu-miR-7573
Stem-Loop ipu-mir-7573
Sequence
aggcugagccugauggcacugag
Get sequence
Deep sequencing reads, experiments

References

1