Mature sequence ipu-miR-457b

Accession numberMIMAT0029577
IDipu-miR-457b
Stem-Loop ipu-mir-457b
Sequence
uagcagcacaucaauauuggca
Get sequence
Deep sequencing reads, experiments

References

1