Mature sequence mmu-miR-7663-5p

Accession numberMIMAT0029832
IDmmu-miR-7663-5p
Stem-Loop mmu-mir-7663
Sequence
gcugcuuggugaucauccacugu
Get sequence
Deep sequencing6 reads, 6 experiments
Predicted targets

References

1