Mature sequence hsa-miR-548ba

Accession numberMIMAT0031175
IDhsa-miR-548ba
Stem-Loop hsa-mir-548ba
Sequence
aaagguaacugugauuuuugcu
Get sequence
Deep sequencing4733 reads, 79 experiments
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).