Mature sequence ppe-miR156g

Accession numberMIMAT0031434
IDppe-miR156g
Stem-Loop ppe-MIR156g
Sequence
uugacagaagauagagagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).