Mature sequence cel-miR-355-3p

Accession numberMIMAT0031895
IDcel-miR-355-3p
Stem-Loop cel-mir-355
Sequence
uagcuucuugcuaaaacaugcc
Get sequence
Deep sequencing7 reads, 6 experiments

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3