Mature sequence dre-miR-200a-5p

Accession numberMIMAT0031984
IDdre-miR-200a-5p
Stem-Loop dre-mir-200a
Sequence
caucuuaccggacagugcugga
Get sequence
Deep sequencing1586 reads, 11 experiments
Database links
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).