Mature sequence gma-miR5035-3p

Accession numberMIMAT0032121
IDgma-miR5035-3p
Stem-Loop gma-MIR5035
Sequence
uguuuagaagcucauagaauagau
Get sequence
Deep sequencing reads, experiments

References

1
2