Mature sequence cfa-miR-889

Accession numberMIMAT0034387
IDcfa-miR-889
Stem-Loop cfa-mir-889
Sequence
uuaauaucggacaaccauuguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).