Mature sequence bdi-miR2118a

Accession numberMIMAT0035531
IDbdi-miR2118a
Stem-Loop bdi-MIR2118a
Sequence
uuuccgaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).