Mature sequence mmu-miR-935

Accession numberMIMAT0035718
IDmmu-miR-935
Stem-Loop mmu-mir-935
Sequence
cccaguuaccgcuuccgcuaccgc
Get sequence
Deep sequencing2479 reads, 65 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).