Mature sequence tae-miR9659-3p

Accession numberMIMAT0035767
IDtae-miR9659-3p
Stem-Loop tae-MIR9659
Sequence
uccaaugguuguucacggcauc
Get sequence
Deep sequencing8 reads, 8 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).