Mature sequence tae-miR9660-5p

Accession numberMIMAT0035768
IDtae-miR9660-5p
Stem-Loop tae-MIR9660
Sequence
uugcgagcaacggaugaauc
Get sequence
Deep sequencing524 reads, 110 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).