Mature sequence tae-miR396-5p

Accession numberMIMAT0035771
IDtae-miR396-5p
Stem-Loop tae-MIR396
Sequence
aacugugaacucgcggggaug
Get sequence
Deep sequencing17754 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).