Mature sequence tae-miR5062-5p

Accession numberMIMAT0035781
IDtae-miR5062-5p
Stem-Loop tae-MIR5062
Sequence
ugaaccuuagggaacagccgcau
Get sequence
Deep sequencing66340 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).