Mature sequence tae-miR6197-5p

Accession numberMIMAT0035806
IDtae-miR6197-5p
Stem-Loop tae-MIR6197
Sequence
ucuguaaacaaauguaggacg
Get sequence
Deep sequencing2046 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).