Mature sequence tae-miR9679-5p

Accession numberMIMAT0035808
IDtae-miR9679-5p
Stem-Loop tae-MIR9679
Sequence
cagaaccagaaugaguagcuc
Get sequence
Deep sequencing9413 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).