Mature sequence chi-miR-133b

Accession numberMIMAT0035949
IDchi-miR-133b
Stem-Loop chi-mir-133b
Sequence
uuugguccccuucaaccagcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).