Mature sequence chi-miR-134

Accession numberMIMAT0035951
IDchi-miR-134
Stem-Loop chi-mir-134
Sequence
ugugacugguugaccagagggg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).