Mature sequence chi-miR-196a

Accession numberMIMAT0036032
IDchi-miR-196a
Stem-Loop chi-mir-196a
Sequence
uagguaguuucauguuguugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).