Mature sequence chi-miR-206

Accession numberMIMAT0036052
IDchi-miR-206
Stem-Loop chi-mir-206
Sequence
uggaauguaaggaaguguguggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).