Mature sequence chi-miR-376d

Accession numberMIMAT0036189
IDchi-miR-376d
Stem-Loop chi-mir-376d
Sequence
aucauagaggaaaauccacau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).