Mature sequence chi-miR-758

Accession numberMIMAT0036292
IDchi-miR-758
Stem-Loop chi-mir-758
Sequence
uuugugaccugguccacuaacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).