Mature sequence chi-miR-96

Accession numberMIMAT0036309
IDchi-miR-96
Stem-Loop chi-mir-96
Sequence
uuuggcacuagcacauuuuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).