Mature sequence gma-miR9749

Accession numberMIMAT0036376
IDgma-miR9749
Stem-Loop gma-MIR9749
Sequence
uuagcuucuuucaccuuuccc
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).
3