Stem-loop gma-MIR9749

Accession

MI0031038

Description

Glycine max gma-MIR9749 precursor miRNA

Sequence

gggcguauuaacugagagugugagaggugaaggaagcuaaucuugaccauucaaucuuaauagggauucgguguucgugaUUAGCUUCUUUCACCUUUCCCacuuucaccuaauaggcuc
((((.(((((..((((((((.(((((((((((((((((((((.(((.((((.((((((....)))))).)))).))).))))))))))))))))))))).))))))))..))))).))))

Structure

    g     ac        u                     u   c    c      a 
gggc uauua  ugagagug gagaggugaaggaagcuaauc uga cauu aaucuu a
|||| |||||  |||||||| ||||||||||||||||||||| ||| |||| ||||||  
cucg auaau  acuuucaC CUUUCCACUUUCUUCGAUUag gcu gugg uuaggg u
    g     cc        C                     u   u    c      a 

Annotation confidence Not enough data

Genome context

chr17: 13919131-13919250 [-]

Mature gma-miR9749

• Accession: MIMAT0036376
• Description: Glycine max gma-miR9749 mature miRNA
• Sequence: 81 - UUAGCUUCUUUCACCUUUCCC - 101
• Evidence: experimental ; Illumina [1-3]

References

1. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153


2. PubMed ID: 25747880
   Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean
   "Zhao M, Meyers BC, Cai C, Xu W, Ma J"
   "Plant Cell (2015) 27:546-562


3. PubMed ID: 25465409
   An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes
   "Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC"
   "Plant Cell (2014) 26:4584-4601