Mature sequence gma-miR399i

Accession numberMIMAT0036382
IDgma-miR399i
Stem-Loop gma-MIR399i
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing reads, experiments

References

1