Mature sequence tae-miR9672b

Accession numberMIMAT0036984
IDtae-miR9672b
Stem-Loop tae-MIR9672b
Sequence
uaccacgacugucauuaagca
Get sequence
Deep sequencing454084 reads, 116 experiments

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).