Mature sequence tae-miR9653b

Accession numberMIMAT0036996
IDtae-miR9653b
Stem-Loop tae-MIR9653b
Sequence
uggccaaggucucuugaggcu
Get sequence
Deep sequencing28226 reads, 116 experiments

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).